Informácie

RNA polymeráza a DNA helikáza

RNA polymeráza a DNA helikáza


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je DNA helikáza alebo RNA polymeráza zodpovedná za prerušenie vodíkovej väzby medzi 2 vláknami počas transkripcie pre eukaryotické bunky? Moja učebnica (WJEC Biology for AS level) hovorí, že je to DNA helikáza, ktorá láme vodíkové väzby, zatiaľ čo RNA polymeráza katalyzuje tvorbu väzieb medzi nukleotidmi RNA.

Enzým DNA helikáza ruší vodíkové väzby medzi bázami v špecifickej oblasti molekuly DNA. To spôsobí, že sa tieto dve vlákna oddelia a rozvinú, čím sa odhalia nukleotidové bázy. Enzým RNA polymeráza sa viaže na templátový reťazec DNA na začiatku sekvencie, ktorá sa má skopírovať.

Keď som však hľadal online, napríklad na https://en.wikiversity.org/wiki/Effect_of_hydrogen_bond_on_RNA

Transkripciu možno ľahko vysvetliť v 4 alebo 5 jednoduchých krokoch, z ktorých každý sa pohybuje ako vlna pozdĺž DNA. RNA polymeráza rozvinie/"rozbalí" DNA prerušením vodíkových väzieb medzi komplementárnymi nukleotidmi. Nukleotidy RNA sú spárované s komplementárnymi bázami DNA. RNA cukor-fosfátový hlavný reťazec sa tvorí s pomocou RNA polymerázy.

Potom RNA polymeráza preruší vodíkové väzby? Ak RNA polymeráza môže rozbiť vodíkové väzby medzi vláknami, aká je potom úloha DNA helikázy v procese transkripcie?


Vylúčenie zodpovednosti

Ako som zdôraznil vo svojom komentári, nie je jasné, či sa uvedené zdroje týkajú eukaryotov alebo prokaryotov, za predpokladu, že sú správne. Som prekladateľ, nie prepisovač, a tak na to odpovedám z vydania Berg z roku 2002 a kol. 'Biochémia', keďže náhodou mám vlastnú kópiu (darček z čias, keď som ešte učil) a toto vydanie je voľne dostupné online. Členom zoznamu s väčšími odbornými znalosťami v tejto oblasti odporúčame uverejňovať komentáre, aby opravili chyby v mojej odpovedi alebo dodali aktualizácie.

Odpoveď

  1. v ani prokaryoty, ani eukaryoty je DNA helikáza, ktorá pôsobí počas replikácie DNA zapojenej do transkripcie, hoci iné proteíny potrebné na transkripciu majú aktivitu DNA helikázy.

  2. In prokaryoty zdá sa, že holoenzým RNA polymerázy (tvorený iba štyrmi podjednotkami) je zodpovedný za uvoľnenie asi 17 párov báz templátovej DNA. Citácia z časti 28.1.3:

    Každá naviazaná molekula polymerázy rozvinie 17-bp segment DNA, čo zodpovedá 1,6 otáčkam špirály B-DNA

    Môže existovať určitá nejednoznačnosť spôsobená opisom, ako bola táto hodnota určená experimentálne, pretože zahŕňala pridanie topoizomerázy II. Z diskusie inde je však jasné, že ide o enzým replikácie DNA a nezúčastňuje sa transkripcie.

  3. In eukaryoty transkripcia je oveľa zložitejšia a zahŕňa samostatné polymerázy pre rôzne triedy produktov RNA a množstvo pomocných transkripčných faktorov v prípade RNA polymerázy II, ktorá prepisuje mRNA. Podľa časti 28.2.4:

    TATA box DNA sa viaže na konkávny povrch TBP [proteín viažuci TATA-box]. Táto väzba vyvoláva veľké konformačné zmeny vo viazanej DNA. Dvojitá špirála je v podstate odvinutá, aby sa rozšírila jej menšia drážka, čo jej umožňuje vytvoriť rozsiahly kontakt s antiparalelnými β vláknami na konkávnej strane TBP.

    Takže počiatočné rozpoznanie boxu TATA spôsobuje určité uvoľnenie. Zdá sa však, že hlavným hráčom je transkripčný faktor TFIIF:

    ATP-dependentná helikáza, ktorá spočiatku oddeľuje DNA duplex pre polymerázu


RNA polymeráza alebo DNA helikáza. A génová expresia.

Takže počas transkripcie v jadre je reťazec DNA „rozzipsovaný“, takže sekvencia komplementárnych báz môže byť skopírovaná a mRNA vyňatá z jadra na ribozóm. Je to DNA helikáza, ktorá ruší vodíkové väzby v DNA, alebo je to RNA polymeráza? Myslel som, že to bola DNA helikáza, ktorá prerušila vodíkové väzby / alebo rozbalila, a RNA polymeráza, ktorá zhromažďuje všetky zložky, aby vytvorili vlákno mRNA. Je to správne a opravte všetko, čo som sa pomýlil.

TIEŽ, aký je rozdiel medzi génom operátora a oblasťou promótora? Je to tak, že: molekula represora sa pripojí k génu operátora, aby zabránila naviazaniu RNA polymerázy, ale ak molekula represora chýba, oblasť promótora je miesto, kde sa bude viazať RNA polymeráza? Opäť prosím opravte všetko, čo je nesprávne, trochu ma to mätie

Ďakujem

Nie to, čo ste hľadali? Skúste&hellip

(Pôvodný príspevok od ilovefruit)
Takže počas transkripcie v jadre je reťazec DNA „rozzipsovaný“, takže sekvencia komplementárnych báz môže byť skopírovaná a mRNA vyňatá z jadra na ribozóm. Je to DNA helikáza, ktorá ruší vodíkové väzby v DNA, alebo je to RNA polymeráza? Myslel som si, že to bola DNA helikáza, ktorá prerušila vodíkové väzby / alebo rozbalila, a RNA polymeráza, ktorá zhromažďuje všetky zložky, aby vytvorili vlákno mRNA. Je to správne a opravte všetko, čo som sa pomýlil.

TIEŽ, aký je rozdiel medzi génom operátora a oblasťou promótora? Je to tak, že: molekula represora sa pripojí k génu operátora, aby zabránila naviazaniu RNA polymerázy, ale ak molekula represora chýba, oblasť promótora je miesto, kde sa bude viazať RNA polymeráza? Opäť prosím opravte všetko, čo je nesprávne, trochu ma to mätie

Ďakujem


Génová expresia: Transkripcia genetického kódu

RNA polymeráza I a III-riadená transkripcia

Eukaryotické RNA polymerázy I a III sa pri iniciácii transkripcie spoliehajú na odlišný súbor proteínov. Hoci obe RNA polymerázy I a III zdieľajú niekoľko identických podjednotiek jadrového enzýmu s RNA polymerázou II, rozpoznávajú veľmi odlišné promótorové sekvencie a majú jedinečné všeobecné transkripčné faktory. Promótory rozpoznávané RNA polymerázou I nie sú dobre konzervované v sekvencii od jedného druhu k druhému. Všetky však majú podobnú všeobecnú architektúru promótora, pretože pozostáva z jadrového prvku obklopujúceho miesto začiatku transkripcie a prvku upstream promótora, ktorý je asi o 100 bp ďalej proti smeru transkripcie. RNA polymeráza I, ktorá transkribuje gény rRNA, sa viaže na promótor obsahujúci element jadrového promótora a upstream kontrolný element (UCE). TBP, ktorý je súčasťou väčšieho komplexu nazývaného SL1, pomáha RNA polymeráze I rozpoznať jadrový promótor (obr. 3.22). Klasické promótory RNA polymerázy III sú Typ I a Typ II, ktoré majú promótory, ktoré ležia úplne v génoch. Tieto gény typu I a typu II zahŕňajú rôzne gény RNA, ako je tRNA, 5S RNA podjednotka ribozómu a gény VA RNA adenovírusu (obr. 3.23). Promótory RNA polymerázy III typu III sú neklasické a podobajú sa promótorom génov triedy II vrátane génu U6 snRNA, génu 7SL RNA a génu 7SK RNA.

Obr. 3.22. Promótory RNA pol I obsahujú jadrovú oblasť, ako aj upstream kontrolný prvok (UCE), ktoré interagujú s transkripčnými faktormi, ako sú UBF a SL1 u ľudí.

Obr. 3.23. Príklady promótorov RNA polymerázy III. Červené rámčeky označujú promótory génov 5S rRNA, tRNA a U6 snRNA. DSE predstavuje prvok distálnej sekvencie, PSE predstavuje prvok proximálnej sekvencie.


Cicavčie bunky dokážu konvertovať segmenty RNA späť na DNA, odhaľuje nový výskum

Tím výskumníkov z Thomas Jefferson University, Philadelphia, University of Southern California, Beckman Research Institute of City of Hope a New York University School of Medicine poskytol prvý dôkaz, že sekvencie RNA možno zapísať späť do DNA, výkon bežnejší vo vírusoch ako v eukaryotických bunkách.

Ternárna štruktúra Polθ na DNA/RNA primer-templáte: (A) Polθ polymeráza (B) DNA/RNA predĺženie Polθ a PolθΔL (C) štruktúra Polθ:DNA/RNA:ddGTP (D) superpozícia Polθ:DNA/ RNA (morská) a Polθ:DNA/DNA (oranžová, 4x0q) subdomény prstov a palca prechádzajú rekonfiguráciou (E) superpozíciou Polθ:DNA/RNA (námorná) a Polθ:DNA/DNA (oranžová, 4x0q) zvýraznením 12- Å posun K2181 (modrý rámček palca) a 4,4-Á posun E2246 (sivý rámček dlane) (F) superpozícia nukleových kyselín a ddGTP zo štruktúr Polθ:DNA/RNA:ddGTP a Polθ:DNA/DNA:ddGTP (G ) hore: elektrónová hustota ddGTP a 3′ koniec priméru v štruktúre Polθ:DNA/RNA dole: zväčšený obrázok superpozície aktívnych miest, ilustrujúci odlišnú konformáciu ddGTP v Polθ:DNA/RNA (modrá) a Polθ :DNA/DNA (losos) komplexy (H) interakcie medzi ribózovými 2'-hydroxylovými skupinami templátu RNA a zvyškami v štruktúre Polθ:DNA/RNA červené prerušované čiary, vodíkové väzby (I) DNA/RNA použitá na kokryštalizáciu s Polθ a ddGTP (hore) je prítomná silná elektrónová hustota pre štyri páry báz [nukleotidy umiestnené v pozíciách 2 až 5 (podčiarknuté) DNA/RNA] a dva páry báz, ktoré sú výsledkom inkorporovaného ddGMP (2',3' dideoxyguanozínmonofosfát ) (zelená pozícia 1) a viazaný neinkorporovaný ddGTP (červená pozícia 0) v interakciách aktívneho miesta (hore) medzi Polθ a nukleovými kyselinami v Polθ:DNA/RNA:ddGTP (dole) interakciách medzi zvyškami a fosfátovou kostrou, cukrovým kyslíkom, alebo nukleobázy sú znázornené modrou, žltou a zelenou farbou, v tomto poradí sú vyznačené vodíkové väzby medzi Polθ a ribózovými 2'-hydroxylovými skupinami (zvyšky v rámčeku) (J) interakcie medzi Polθ a nukleovými kyselinami v Polθ:DNA/DNA:ddGTP (4x0q) farebná schéma identická s (I). Obrazový kredit: Chandramouly a kol., doi: 10.1126/sciadv.abf1771.

"Skutočnosť, že ľudská polymeráza to dokáže s vysokou účinnosťou, vyvoláva veľa otázok."

"Napríklad toto zistenie naznačuje, že správy RNA možno použiť ako šablóny na opravu alebo prepísanie genómovej DNA."

Vo svojej štúdii sa Dr. Pomerantz a kolegovia zamerali na veľmi nezvyčajnú polymerázu nazývanú polymeráza theta (Polθ).

Zo 14 DNA polymeráz v cicavčích bunkách iba tri vykonávajú väčšinu práce duplikácie celého genómu na prípravu bunkového delenia.

Zvyšných 11 sa väčšinou podieľa na detekcii a opravách, keď dôjde k prerušeniu alebo chybe v reťazcoch DNA.

Polθ opravuje DNA, ale je veľmi náchylný na chyby a robí veľa chýb alebo mutácií.

Vedci si všimli, že niektoré z vlastností Polθ boli tie, ktoré zdieľal s iným celulárnym strojom, aj keď jeden bežnejší vo vírusoch — reverznej transkriptáze.

Rovnako ako Polθ, HIV reverzná transkriptáza pôsobí ako DNA polymeráza, ale môže tiež viazať RNA a čítať RNA späť do reťazca DNA.

V sérii experimentov autori testovali Polθ proti reverznej transkriptáze z HIV, ktorá je jednou z najlepšie študovaných svojho druhu.

Ukázali, že Polθ bol schopný konvertovať RNA správy na DNA, čo dokázal, rovnako ako HIV reverzná transkriptáza, a že v skutočnosti urobil lepšiu prácu ako pri duplikácii DNA na DNA.

Polθ bol účinnejší a zaviedol menej chýb pri použití RNA templátu na písanie nových správ DNA, ako pri duplikovaní DNA do DNA, čo naznačuje, že táto funkcia by mohla byť jej primárnym účelom v bunke.

Pomocou röntgenovej kryštalografie tím zistil, že táto molekula bola schopná zmeniť tvar, aby sa prispôsobila objemnejšej molekule RNA – čo je medzi polymerázami unikát.

"Náš výskum naznačuje, že hlavnou funkciou Polθ je pôsobiť ako reverzná transkriptáza," povedal Dr. Pomerantz.

"V zdravých bunkách môže byť účelom tejto molekuly oprava DNA sprostredkovaná RNA."

"V nezdravých bunkách, ako sú rakovinové bunky, je Polθ vysoko exprimovaný a podporuje rast rakovinových buniek a rezistenciu voči liekom."

"Bude vzrušujúce ďalej pochopiť, ako Polθova aktivita na RNA prispieva k oprave DNA a proliferácii rakovinových buniek."


MATERIÁLY A METÓDY

Testy predlžovania primer-templát

Relatívna rýchlosť aktivity RT (obr. 1B). Polθ (0,5 nM), HIV RT a Polη (katalytické jadro, zvyšky 1 až 514) sa inkubovali s 10 nM rádioaktívne značeným templátom DNA/RNA (RP559/RP493R) po uvedené časy v pufri A [25 mM tris-HCl (pH 7,8), 10 mM MgCl20,01 % (v/v) NP-40, 1 mM ditiotreitol (DTT), hovädzí sérový albumín (BSA 0,1 mg/ml) a 10 % (v/v) glycerol] so 100 uM dNTP pri 37 °C. Percento predĺženia sa určilo vydelením intenzity predĺženého produktu intenzitou súčtu predĺžených a nepredĺžených produktov pre každý pruh. Všetky reakcie primér-templát sa ukončili 25 mM EDTA a 45 % (obj./obj.) formamidom, potom sa rozdelili v polyakrylamidových géloch denaturujúcich močovinu a vizualizovali sa pomocou PhosphorImager. Rýchlosť RT aktivity sa určila zo sklonu lineárnej časti grafu reprezentujúceho podmienky ustáleného stavu.

Porovnanie polymerázových aktivít na DNA/DNA a DNA/RNA (obr. 1, D až G). Testy predlžovania primérov na templátoch DNA/RNA (RP559/RP493R) a DNA/DNA (RP559/RP493D) sa uskutočňovali s použitím podmienok na obr. 1B s nasledujúcimi zmenami. Použili sa uvedené koncentrácie uvedených polymeráz a reakcie sa uskutočňovali 32 minút.

Relatívna aktivita RT (obr. 1H). Uvedené polymerázy sa inkubovali s 10 nM rádioaktívne značeným templátom DNA/RNA (SM98/SM44R) počas 20 minút v prítomnosti 10 uM dNTP pri 37 °C. Reakcie Pol9 a HIV RT sa uskutočnili v 25 mM Tris-HCl (pH 8,0), 10 mM KCI, 10 mM MgCl20,01 % (v/v) NP-40, 1 mM DTT, BSA (0,1 mg/ml) a 10 % (v/v) glycerolu. Reakcie obsahujúce AMV RT (20 jednotiek, New England Biolabs) sa uskutočnili v pufri [50 mM tris-acetát (pH 8,3), 75 mM octan draselný, 8 mM octan horečnatý a 10 mM DTT] a obsahoval BSA (0,1 mg/ ml). Reakcie obsahujúce M-MuLV RT (400 jednotiek, New England Biolabs) sa uskutočnili v pufri [50 mM tris-HCl (pH 8,3), 75 mM KCl, 3 mM MgCl2a 10 mM DTT] a obsahoval BSA (0,01 mg/ml).

Porovnanie aktivít RT a DNA-dependentnej syntézy DNA pomocou skráteného a úplného Polθ (obr. 1J). Sto nanomolov uvedených polymeráz sa inkubovalo s 10 nM rádioaktívne značenou DNA/RNA (SM98/SM44R) alebo DNA/DNA (SM98/SM44) počas 45 minút s 50 uM dNTP a 25 mM tris-HCl (pH 7,8), 2 mM MgCl24 mM KCI, 6 mM NaCl, 0,01 % (v/v) NP-40, 1 mM DTT, BSA (0,1 mg/ml), 10 % (v/v) glycerolu a 750 uM adenozíntrifosfátu (ATP) pri 37 °C.

Relatívna rýchlosť inkorporácie jedného dNMP do rádioaktívne značenej DNA/RNA (obr. 2, A až E). Pol9 (2 nM) sa inkuboval so 100 nM uvedených rádioaktívne značených templátov DNA/RNA a DNA/DNA počas uvedených časov s 300 uM uvedeného dNTP v pufri [25 mM tris-HCl (pH 8,0), 10 mM MgCl24 mM KCI, 6 mM NaCI, 0,01 % NP-40, 1 mM DTT, BSA (0,01 mg/ml) a 10 % (v/v) glycerol] pri 37 °C. Percento predĺženia bolo stanovené tak, ako je opísané vyššie.

Relatívna rýchlosť nesprávneho začlenenia nukleotidov (dNMP) (obr. 2, F až J). Pol9 (20 nM) sa inkuboval so 100 nM uvedených rádioaktívne značených templátov DNA/RNA a DNA/DNA a 300 uM uvedeného dNTP počas uvedených časov v pufri [25 mM tris-HCl (pH 8,0), 10 mM MgCl210 mM KCI, 0,01 % (v/v) NP-40, 1 mM DTT, BSA (0,1 mg/ml) a 10 % (v/v) glycerol]. Percento predĺženia bolo stanovené tak, ako je opísané vyššie. Všetky oligonukleotidy boli rádioaktívne označené pomocou T4 polynukleotidkinázy (New England Biolabs) a32P-y-ATP (PerkinElmer) v odporúčanom pufri pri 37 °C počas aspoň 1 hodiny.

MMEJ bunkový test

Niektoré tu použité metódy sú podobné metódam v predtým publikovanom článku (38). iPSC (2 x 105) boli transfekované v suspenzii s 0,25 ug každého z uvedených ľavo- a pravostranných DNA GFP konštruktov s použitím Lipofectamine 2000 (Invitrogen). Ako negatívna kontrola sa na transfekciu v kontrolných jamkách použil podobný objem pufra, aký bol použitý v experimentálnych jamkách. Ako pozitívna kontrola na meranie účinnosti transfekcie sa súčasne transfekoval expresný konštrukt lineárnej DNA GFP divokého typu. Frekvencie GFP-pozitívnych buniek sa merali 3 dni po transfekcii prietokovou cytometriou s použitím GUAVA easyCyte 5-HT (Luminex Corp.) v nezávislých replikátoch a korigovali sa na účinnosť transfekcie a udalosti pozadia. Údaje sú reprezentované ako priemer a SEM z troch nezávislých experimentov, s aspoň duplikátmi na experiment. Štatistická analýza bola vykonaná párom t test.

Príprava reportérových konštruktov GFP MMEJ

Niektoré tu použité metódy sú podobné metódam v predtým publikovanom článku (38). Príprava polymerázovej reťazovej reakcie (PCR) dodržiavala odporúčané podmienky pre Phusion High-Fidelity DNA polymerázu (New England Biolabs M0530) s použitím 10 ng plazmidu pCMV-GFP ako templátu v 1x Phusion HF pufri. PCR pre DNA ľavého boku sa uskutočnila s primérmi RP500B a RP501. PCR pre DNA pravého boku sa uskutočnila s primérmi RP502 a RP503B. Po PCR sa produkty DNA ľavého alebo pravého boku spojili a štiepili s Dpn I (New England Biolabs) v 1 x CutSmart pufri a potom sa purifikovali pomocou Qiagen QIAquick PCR Purification Kit. PCR sa potom konjugovala so streptavidínom pomocou PCR (110 ng/ul) a streptavidínom (0,8 ug/ul) v 10 mM tris-HCl (pH 7,5) a 100 mM NaCI pri 37 °C počas 1 hodiny. PCR pre DNA ľavého boku s piatimi po sebe idúcimi ribonukleotidmi sa uskutočnila s primérmi RP500B a RP501. PCR bola purifikovaná a potom štiepená Dpn I (New England Biolabs) a Sap I v 1 x CutSmart pufri. PCR sa znova purifikovala a potom sa ligovala do dvojvláknovej DNA zloženej z anelovaných oligonukleotidov RP550R-P a RP530a [oligo sa anelovali v prítomnosti inhibítora ribonukleázy (RNázy)] počas 16 hodín pri 16 °C pomocou T4 DNA ligázy (New England Biolabs) v 1 x T4 DNA ligázovom pufri. Ligovaná PCR bola purifikovaná a potom konjugovaná so streptavidínom, ako je opísané vyššie. PCR pre DNA ľavého boku s 10 po sebe idúcimi ribonukleotidmi sa pripravila rovnakou metodológiou s ligáciou na dvojvláknovú DNA zloženú z oligonukleotidov RP546P a RP530. Kroky konjugácie streptavidínu a amplifikácie DNA boli potvrdené na agarózových géloch zafarbených etídiumbromidom.

CRISPR-Cas9 knock-in GFP reportérový test

U2OS rodičovský a POLQ e16m bunkové línie s ∆7-reportérom a plazmidmi CAS9/single guide RNA (sgRNA) na zacielenie na DSB v tomto reportéri, DNA oligonukleotidový templát a kontrolný oligonukleotid (LUC) už boli opísané (36). Oligonukleotid R2 má rovnakú sekvenciu ako oligonukleotidy DNA, ale dve bázy RNA v 7 nt chýbajú z ∆7-reportéra (IDT). Bunkové línie sa vysiali v množstve 1 x 105 na 12-jamkovú misku a nasledujúci deň sa transfekovali a % GFP sa analyzovalo 3 dni po transfekcii pomocou cytometra CyAN-ADP (DAKO) a normalizovalo sa na účinnosť transfekcie, ako už bolo opísané (36). Transfekcie pre reportérový test obsahovali 400 ng každého plazmidu CAS9/sgRNA, 10 pmol oligonukleotidu a 100 ng buď pCAGGS-BSKX (prázdny vektor) alebo expresného vektora FLAG-POLQ (38). Transfekcie na účinnosť transfekcie obsahovali 400 ng pCAGGS-NZE-GFP (expresný vektor GFP), 500 ng prázdneho vektora (EV) a 10 pmol kontrolného oligonukleotidu (36). Transfekcie sa uskutočnili so 4 ul Lipofectamine 2000 (Thermo Fisher Scientific) v 0,2 ml Optimem (Thermo Fisher Scientific) a inkubovali sa s bunkami v 1 ml média bez antibiotík počas 4 hodín. Imunoblotovacia analýza pre FLAG-POLQ zahŕňala extrakciu pomocou ELB [250 mM NaCl, 5 mM EDTA, 50 mM Hepes, 0,1 % (v/v) Ipegal a inhibítor proteázy Roche] so sonikáciou (Qsonica, Q800R) a použitím protilátok pre FLAG ( Sigma-Aldrich, A8592) alebo ACTIN (Sigma-Aldrich, A2066). Sekvenčná analýza reportérového testu s R2 oligo: Bunky sa transfekovali ako pre reportérový test s R2 oligonukleotidovým templátom v POLQ e16m bunky s expresným vektorom POLQ sa bunky GFP + izolovali triedením buniek aktivovaným fluorescenciou (FACS) (Becton Dickinson Aria Sorter) a produkt opravy GFP sa amplifikoval pomocou CMVFWDFRT5 5′ CGCAAATGGGCGGGTAGGCGTG a BGHREVFRT5 5′CAGGTCTAGDFARTAG so sekvenciou CCAGGTCDDFGARTAG primer.

Syntéza cDNA

Reakcie syntézy cDNA sa uskutočnili indikovanou polymerázou v prítomnosti 100 μM dNTP a optimálneho pufra pre každý enzým: Polθ [25 mM tris-HCl (pH 8,0), 10 mM KCl, 10 mM MgCl20,01 % (v/v) NP-40, 1 mM DTT, BSA (0,1 mg/ml) a 10 % (v/v) glycerol] AMV RT [50 mM tris-acetát (pH 8,3), 75 mM draslík acetát, 8 mM octan horečnatý, 10 mM DTT a BSA (0,1 mg/ml)] a M-MuLV RT [50 mM tris-HCl (pH 8,3), 75 mM KCI, 3 mM MgCl2a 10 mM DTT]. Reakcie so syntetickou DNA/RNA obsahovali 10 ng templátu. Pol9 (100 nM), AMV-RT (20 jednotiek) alebo M-MuLV RT (400 jednotiek) sa inkubovali pri 37 °C (Pol8) alebo 42 °C (AMV-RT a M-MuLV RT) počas 1 hodiny. Enzýmy sa potom tepelne inaktivovali pri 85 °C počas 20 minút. cDNA (0,1875 ng) sa použila na PCR v reálnom čase (Power SYBR Green Master Mix, Thermo Fisher Scientific) s použitím primérov SM246 a SM247.

Proteíny

Polθ, Fl-Polθ a Polδ boli purifikované, ako už bolo opísané (1, 9). Pols β a λ poskytol S. Wilson. PolK bol zakúpený od Enzymax LLC. HIV RT RT52A optimalizovaný pre rôntgenovú kryštalografiu poskytol Dr. E. Arnold. Polη poskytol Dr. S. Arora. Pols ε a α poskytol Dr. M. O’Donnell. Polγ Exo- poskytol Dr. W. Copeland. M-MuLV, AMV RT a KF Pols boli zakúpené od New England Biolabs.

Purifikácia proteínov pre rôntgenovú kryštalografiu

Gén kódujúci Pol9 (zvyšky 1819 až 2590) sa optimalizoval kodónom a klonoval sa do vektora pSUMO, aby sa vytvorila sumo fúzia, ktorá nesie N-koncovú značku 6xHis a miesto štiepenia proteázy PreScission. Polθ-vyjadrujúce E. coli Bunky Rosetta(DE3)pLysS sa kultivovali pri 37 °C v LB médiu až do optickej hustoty pri 600 nm (OD600) dosiahla 0,3, teplota rastu sa potom znížila na 16 °C a E. coli bunky sa ďalej kultivovali. Expresia proteínu bola indukovaná pridaním 0,1 mM izopropyl-p-d-tiogalaktopyranozidu, keď OD600 dosiahli 0,7 až 0,9. E. coli bunky sa kultivovali pri 16 °C cez noc a zozbierali sa centrifugáciou. Bunková peleta bola resuspendovaná v pufri L [50 mM Hepes (pH 8,0), 500 mM NaCl, 0,005 % (obj./obj.) Igepal CA 630 a 0,5 mM TCEP] lyzovaná sonikáciou alebo French Press v prítomnosti DNázy I (20 ug/ml), RNáza A (30 ug/ml), 5 mM MgCl22 mM CaCl2a 1 mM fenylmetylsulfonylfluoridu a potom sa odstredí pri 12 000g počas 45 min. 6xHis sumo fúzia bola zachytená Ni-NTA agarózovou gravitačnou prietokovou chromatografiou, po ktorej nasledovala séria premytí pufrom W [50 mM Hepes (pH 8,0), 500 mM NaCl, 0,005 % (v/v) Igepal CA 630, 0,5 mM TCEP a 10 mM imidazol]. Pridalo sa päť mililitrov pufra L a Precission Protease, aby sa odštiepil Pol9 z 6xHis tagu cez noc pri 4 °C. Odštiepený Pol9 sa eluoval ešte dvakrát 5 ml pufra L. Eluovaný proteín sa purifikoval do homogenity pomocou HiTrap heparínovej kolóny (GE Healthcare Life Sciences). Proteín sa skoncentroval na 5 mg/ml v pufri z octanu amónneho (150 mM), KCI (150 mM), tris-HCl pufra (pH 8,0) (40 mM), TCEP (2,5 mM) a glycerolu (1 % v/v).

Kryštalizácia a stanovenie štruktúry

Podmienky kryštalizácie boli identifikované širokou matricou. Kryštalizačné skríningové platne v sedacej kvapke boli nastavené na 18 °C s použitím ARI Crystal Gryphon Robot (ARI) a kryštalizačných skríningových roztokov (Qiagen and Hampton Research). Reakcia Polθ (2,5 mg/ml) s hybridom DNA/RNA (primér DNA: 5′-GCGGCTGTCATT a RNA templát: 5′-CGUCCAAUGACAGCCGC) v prítomnosti ddGTP (1 mM), monolaurát sacharózy (300 μM), MgCl2 (1 mM) a spermín tetrahydrochlorid (20 mM) pripravili vzorku na difúziu kvapiek v sede cez 50 μl zásobník obsahujúci 20 % (w/v) etanol zmiešaním 0,3 μl roztoku v zásobníku s rovnakým dielom reakcie. Riešenie. Kryštály s približnými konečnými rozmermi 20 μm x 20 μm x 20 μm rástli počas nasledujúcich 2 týždňov. Kryoprotekcia bola dosiahnutá slučkou kryštálov do materského roztoku s ďalším 25 % (v/v) glycerolu pred rýchlym ochladením do kvapalného dusíka. Údaje o difrakcii boli zhromaždené na lúčovej čiare 23ID-D Národného inštitútu všeobecných lekárskych vied a zariadenia štrukturálnej biológie Národného inštitútu pre rakovinu v pokročilom zdroji fotónov. Kompletný súbor údajov pre Polθ sa zhromaždil, indexoval, integroval a škáloval pomocou balíka automatického spracovania na serveri APS (GMCAproc). Program Phaser-MR v balíku PHENIX sa použil na molekulárnu náhradu a COOT sa použil na prestavbu modelu a Phenix na simulované žíhanie a zjemnenie. Štruktúra Pol6 bola určená molekulárnou náhradou (MR) s použitím Pol9 [Proteínová databanka (PDB): 4x0q] ako vyhľadávacieho modelu. Úplná štruktúra PDB 4x0q nemohla priniesť riešenie. Roztok MR sa získal iba odstránením niektorých slučiek a odstránením duplexu DNA/DNA z modelu. Počiatočné fázy MR proteínového modelu boli vylepšené cyklickým budovaním a zdokonaľovaním modelu, čo nám umožňuje pomaly zabudovať chýbajúce slučky, preskladané a preorientované domény prstov a palca a zvyšky DNA/RNA na základe vylepšených máp elektrónovej hustoty. . Bol dosiahnutý konečný model s veľmi dobrou štatistikou pre tento rozsah rozlíšenia 3,2 Å (tabuľka S1).

Nukleové kyseliny

Nasledujúce nukleové kyseliny boli zakúpené od Integrated DNA Technologies (uvedené ako 5′-3′ polarita):


Možnosti prístupu

Získajte úplný prístup k denníku na 1 rok

Všetky ceny sú ceny NET.
DPH bude pripočítané neskôr v pokladni.
Výpočet dane bude dokončený pri pokladni.

Získajte časovo obmedzený alebo úplný prístup k článku na ReadCube.

Všetky ceny sú ceny NET.


Funkcia RNA polymerázy

RNA polymeráza je najdôležitejším enzýmom v procese transkripcie. Pamätajte, že transkripcia je proces kopírovania dvojvláknovej DNA do jedného vlákna RNA. Môžu vyzerať trochu inak, ale obe sú napísané v jazyku nukleotidy. Aby mohla RNA polymeráza začať svoju činnosť, musí najprv nájsť vhodnú promotérsky región. Tento región môže byť zameraný na transkripčné faktory v eukaryotoch. Tieto proteíny sa viažu na miesto, čím vytvárajú vhodné usporiadanie pre RNA polymerázu na naviazanie a spustenie transkripcie. V baktériách existuje iba jeden promótor, tzv sigma iniciačný faktor. Tento proces je možné vidieť na zovšeobecnenej molekule polymerizovanej RNA znázornenej nižšie, ktorá prepisuje DNA. Transkripčné faktory nie sú zobrazené.

Keď sa RNA polymeráza viaže na DNA, mení sa konformácia, alebo tvar. Tým sa spustí enzymatická reťazová reakcia, pri ktorej sa z nového reťazca nukleotidov vytvorí molekula RNA založená na predloženom templáte. Keď RNA polymeráza vytvorí túto novú molekulu, RNA sa musí spracovať a uvoľniť z nej jadro. Teraz volaný messenger RNAalebo mRNA, narazí na ribozóm, ktorý má vhodné mechanizmy na proces preklad.

Podobne ako pri preklade angličtiny do španielčiny, ribozóm musí „prečítať“ sekvenciu RNA a previesť správu do jazyka aminokyseliny. Tieto malé molekuly tvoria dlhé reťazce, ktoré sa skladajú do zložitých tvarov, aby sa stali biochemicky aktívnymi proteínmi. Tieto proteíny zase vytvárajú a udržiavajú časti DNA, ako aj replikujú DNA. Časti DNA uchovávajú genetickú informáciu pre samotný proteín RNA polymerázy, ktorý je najskôr dekódovaný molekulou RNA polymerázy. Táto situácia je naozaj základom kurčaťa a vajíčka, ak sa nad tým zamyslíte.


Dostupnosť údajov

  1. Adams PD
  2. Afonine PV
  3. Bunkóczi G
  4. Chen VB
  5. Davis IW
  6. Echols N
  7. Hlava JJ
  8. Zavesené LW
  9. Kapral GJ
  10. Grosse-Kunstleve RW
  11. McCoy AJ
  12. Moriarty NW
  13. Oeffner R
  14. Prečítajte si RJ
  15. Richardson DC
  16. Richardson JS
  17. Terwilliger TC
  18. Zwart PH
  1. Owczarzy R
  2. Tataurov AV
  3. Wu Y
  4. Manthey JA
  5. McQuisten KA
  6. Almabrazi HG
  7. Pedersen KF
  8. Lin Y
  9. Garretson J
  10. McEntaggart NIE
  11. Sailor CA
  12. Dawson RB
  13. Pozrieť AS
  1. Schutz P
  2. Karlberg T
  3. van den Berg S
  4. Collins R
  5. Lehtio L
  6. Hogbom M
  7. Holmberg-Schiavone L
  8. Tempel W
  9. Park HW
  10. Hammarström M
  11. Moche M
  12. Thorsell AG
  13. Schüler H

<p>Táto sekcia poskytuje všetky užitočné informácie o proteíne, väčšinou biologické poznatky.<p><a href='/help/function_section' target='_top'>Viac. </a></p> Funkcia i

RNA-dependentná RNA polymeráza replikuje vírusový genóm zložený z 2 segmentov RNA, RNA1 a RNA2.

<p>Ručne upravované informácie, pre ktoré sú publikované experimentálne dôkazy.</p> <p><a href="/manual/evidences#ECO:0000269">Viac. </a></p> Manuálne tvrdenie založené na experimente v i


Transkripcia/syntéza RNA

mRNA sa tvorí pomocou kódov DNA.

Vysvetlenie:

Tvorba RNA z kódov napísaných na DNA je známa ako transkripcia, pri ktorej sa dvojitá špirála DNA rozbalí a rozvinie.

Potom existujú voľné ribonukleotidy, ktoré sa spárujú s komplementárnymi bázami jedného z exponovaných reťazcov DNA.

Cukor a fosfát susedných ribonukleotidov sa stále spájajú a vytvára sa sacharidová fosfátová kostra RNA. Toto párovanie komplementárnych ribonukleotidov pozdĺž báz reťazca DNA je monitorované RNA polymerázou, enzýmom.

()

Na konci tohto procesu párovania sa vytvorí nová jednovláknová RNA. Novovytvorená RNA môže prejsť spracovaním a neskôr sa použije na syntézu proteínov, t.j. transláciu.

Video nižšie poskytuje súhrn toho, ako prebiehajú procesy transkripcie a prekladu pomocou Shockwave tutoriálu DNA Workshop od PBS.

Odpoveď:

Vysvetlenie:

Existuje veľa podrobností o oboch, do ktorých sa môžete ponoriť na wikipédii, ale hlavný rozdiel je:

Replikácia DNA vytvára dve nové molekuly dvojvláknovej DNA z pôvodnej molekuly dvojvláknovej DNA (semikonzervatívna replikácia).

Transkripcia vytvára jedno vlákno RNA z dvojvlákna DNA (používa jedno vlákno DNA ako templát a vytvára jedno vlákno RNA).

Odpoveď:

Transkripcia je proces, pri ktorom sa vytvára mRNA (Messenger RNA).

Vysvetlenie:

Tu sú kroky prepisu.

DNA je rozopnutá enzýmom "Helikáza".

RNA polymeráza pridáva RNA nukleotidy do nového vlákna RNA. (V RNA je tymín nahradený uracilom.)

mRNA je kompletná, keď dosiahne stop kód na DNA.

mRNA potom opúšťa jadro a prenáša kód do miest syntézy proteínov v cytoplazme. (DNA nikdy neopustí jadro.)


Pozri si video: Репликация ДНК. самое простое объяснение (Smieť 2022).


Komentáre:

  1. Zusho

    I would like to encourage you to visit the site, where there are many articles on the topic that interests you.

  2. Tat

    Je mi ľúto, nič, čo vám nemôžem pomôcť. Ale som si istý, že nájdete správne riešenie. Nezúfajte.

  3. Vigal

    Dobre napísané, ak podrobnejšie, samozrejme. Bolo by to oveľa lepšie. Ale v každom prípade je to pravda.

  4. Gukazahn

    I agree with told all above.

  5. Charleton

    Neporovnateľná fráza, very much je mi príjemná :)

  6. Yozshubar

    Absolútne s vami súhlasím. Myslím, že to je vynikajúci nápad.



Napíšte správu